Review




Structured Review

Benchling Inc crispr guide rna design tool
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pmc13155868-62-34-40?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars, 2026-07
86/100 stars

Images



Similar Products

86
Benchling Inc crispr guide rna design tool
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pmc13155868-62-34-40?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech platform crispr design tool
Platform Crispr Design Tool, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pm42296148-160-18-26?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
platform crispr design tool - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr guide rna design tools benchling
Crispr Guide Rna Design Tools Benchling, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pm42277432-365-25-30?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr guide rna design tools benchling - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Benchling Inc benchling crispr design tool
Benchling Crispr Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pm42243117-265-46-46?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
benchling crispr design tool - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Benchling Inc benchling crispr design webtool
<t>CRISPR/Cas9-mediated</t> knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.
Benchling Crispr Design Webtool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pmc13197774-320-27-32?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
benchling crispr design webtool - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Synthego Inc design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing
<t>CRISPR/Cas9-mediated</t> knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.
Design Optimization Crispr Cas Spcas9 Guide Rna Ggacagaaugaugaaccugg Editing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pm42269214-46-7-18?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
design optimization crispr cas spcas9 guide rna ggacagaaugaugaaccugg editing - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Benchling Inc crispr design tool
<t>CRISPR/Cas9-mediated</t> knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.
Crispr Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/bio_rxiv__64898__2026__05__14__725236-174-19-16?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
crispr design tool - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Synthego Inc crispr design tool accessed on 21 december 2022
<t>CRISPR/Cas9-mediated</t> knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.
Crispr Design Tool Accessed On 21 December 2022, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+system/pm42072337-78-13-12?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
crispr design tool accessed on 21 december 2022 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


CRISPR/Cas9-mediated knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.

Journal: The Journal of Biological Chemistry

Article Title: Deletion of mitochondrial calcium uniporter enhances calcium signals by slowing calcium clearance and triggers adaptive transcriptomic remodeling

doi: 10.1016/j.jbc.2026.111473

Figure Lengend Snippet: CRISPR/Cas9-mediated knockout of Mcu in RBL-2H3 cells. A , exon structure of rat Mcu indicating the target sites of guide RNA1 and guide RNA2. B , quantitative real-time PCR analysis of Mcu mRNA expression in wild-type (WT) RBL-2H3 cells and Mcu knockout (KO) clones A4 and D10 (n = 30 wells; 3 biological replicates). Medians ( bars ) with 95% confidence intervals (error bars ) are displayed on the scatter dot plots. C , immunoblot analysis of WT and Mcu KO clones A4 and D10 using MCU antibodies raised against either the C terminus or N terminus. Vinculin served as a loading control. Molecular weights are indicated in kilodaltons (kDa). MCU, mitochondrial Ca 2+ uniporter.

Article Snippet: Two different guide (g)RNAs targeting rat Mcu (Ensembl Gene ID: ENSRNOG00000045920 ; chromosomal location chr20 29,038,480—29,199,224 [-]; genome: Rnor_6.0 (rn6, Rattus norvegicus )) were designed using the Benchling CRISPR design webtool ( https://benchling.com/crispr ).

Techniques: CRISPR, Knock-Out, Real-time Polymerase Chain Reaction, Expressing, Clone Assay, Western Blot, Control

Mcu knockout by CRISPR/Cas9 causes widespread and divergent transcriptomic changes across clones generated using distinct guide RNAs. A and B , volcano plots showing differentially expressed genes (DEGs) in Mcu −/− clones A4 ( A ) and D10 ( B ) relative to WT cells. Red and blue dots represent significantly upregulated and downregulated genes, respectively. Mcu is shown as a green dot . Gray dots indicate unchanged genes, either with below absolute fold change 2.0 cutoff ( light gray ) or having false discovery rate(FDR) higher than 0.05 ( dark gray ). C , volcano plot comparing A4 and D10 clones directly. D and E , Venn diagrams of downregulated genes ( D ) and upregulated genes ( E ) in A4 versus WT and D10 versus WT, highlighting both overlapping and clone-specific expression changes. F , ingenuity pathway analysis (IPA) of the 213 DEGs common to both clones (64 downregulated and 149 upregulated) with a z-score cutoff of 1.0. G , bubble plot displays enriched canonical pathways predicted by IPA. The y -axis on the right shows enriched pathway names ordered according to hierarchical clustering of their z-scores across two conditions (A4 versus WT and D10 versus WT), with the corresponding dendrogram displayed on the left . The x -axis labels the two conditions. Each pathway is represented by two circles , one for each condition. Circle size corresponds to the gene ratio for that pathway in the given condition. The fill color of each circle reflects the z-score: red for positive z-scores (activation), blue for negative z-scores (inhibition), transparent for values near zero, and gray where the z-score is NA. Threshold of z-score was set to absolute z-score ≥ 1.5. Below cutoff p values ( i.e. , p value > 0.05) are indicated by small lines on the right of the bubble. MCU, mitochondrial Ca 2+ uniporter.

Journal: The Journal of Biological Chemistry

Article Title: Deletion of mitochondrial calcium uniporter enhances calcium signals by slowing calcium clearance and triggers adaptive transcriptomic remodeling

doi: 10.1016/j.jbc.2026.111473

Figure Lengend Snippet: Mcu knockout by CRISPR/Cas9 causes widespread and divergent transcriptomic changes across clones generated using distinct guide RNAs. A and B , volcano plots showing differentially expressed genes (DEGs) in Mcu −/− clones A4 ( A ) and D10 ( B ) relative to WT cells. Red and blue dots represent significantly upregulated and downregulated genes, respectively. Mcu is shown as a green dot . Gray dots indicate unchanged genes, either with below absolute fold change 2.0 cutoff ( light gray ) or having false discovery rate(FDR) higher than 0.05 ( dark gray ). C , volcano plot comparing A4 and D10 clones directly. D and E , Venn diagrams of downregulated genes ( D ) and upregulated genes ( E ) in A4 versus WT and D10 versus WT, highlighting both overlapping and clone-specific expression changes. F , ingenuity pathway analysis (IPA) of the 213 DEGs common to both clones (64 downregulated and 149 upregulated) with a z-score cutoff of 1.0. G , bubble plot displays enriched canonical pathways predicted by IPA. The y -axis on the right shows enriched pathway names ordered according to hierarchical clustering of their z-scores across two conditions (A4 versus WT and D10 versus WT), with the corresponding dendrogram displayed on the left . The x -axis labels the two conditions. Each pathway is represented by two circles , one for each condition. Circle size corresponds to the gene ratio for that pathway in the given condition. The fill color of each circle reflects the z-score: red for positive z-scores (activation), blue for negative z-scores (inhibition), transparent for values near zero, and gray where the z-score is NA. Threshold of z-score was set to absolute z-score ≥ 1.5. Below cutoff p values ( i.e. , p value > 0.05) are indicated by small lines on the right of the bubble. MCU, mitochondrial Ca 2+ uniporter.

Article Snippet: Two different guide (g)RNAs targeting rat Mcu (Ensembl Gene ID: ENSRNOG00000045920 ; chromosomal location chr20 29,038,480—29,199,224 [-]; genome: Rnor_6.0 (rn6, Rattus norvegicus )) were designed using the Benchling CRISPR design webtool ( https://benchling.com/crispr ).

Techniques: Knock-Out, CRISPR, Clone Assay, Generated, Expressing, Activation Assay, Inhibition